circad | circRNAs associated with diseases

hsa_circ_0081001
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink		PMID	30263004
Experimental Method
Sample Type	Tissue and cell lines	Comparison	blood samples (5ml, peripheral vein) from 50 OS patients before surgery, other 30 patients with benign bone tumour
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CATGCAGCCTGGCTCTTACC Reverse CTGCTCCAAGAAAACCTGAAACT	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Kun-Peng, Z, Chun-Lin, Z, Jian-Ping, H, Lei, Z (2018). A novel circulating hsa_circ_0081001 act as a potential biomarker for diagnosis and prognosis of osteosarcoma. Int. J. Biol. Sci., 14, 11:1513-1520.